![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR159b |
|||||
Accession | MI0001093 (change log) | ||||
Description | Oryza sativa miR159b stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
77 open access papers mention osa-MIR159b | ||||
Stem-loop |
u a ug u u aa uaucug - - a a g u guuc uau aua 5' gguua ga g gagcuccuuucg uccaa ga gguu aagg gu gau c gcu cuug ucaug ccac ucuaucuc g ||||| || | |||||||||||| ||||| || |||| |||| || ||| | ||| |||| ||||| |||| |||||||| g 3' cuagu cu c cucgagggaagu agguu cu ccag uucc ca cua g cga gaac aguac ggug ggauagag a u a gu u u ca ---ucg u a a c g c guuu uuc aaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR159b |
|
Accession | MIMAT0001023 |
Sequence |
158 - uuuggauugaagggagcucug - 178 |
Deep sequencing | 2239 reads, 2 experiments |
Evidence | by similarity; MI0000189 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|