Stem-loop sequence osa-MIR167g

Accession

MI0001112 (change log)

Description

Oryza sativa miR167g stem-loop

Gene family

MIPF0000023; MIR167_1

Literature search

82 open access papers mention osa-MIR167g
(245 sentences)

Stem-loop

      a  c             a c         aa  aucu 
5' cau ag aggugaagcugcc g augaucuga  gc    c
   ||| || ||||||||||||| | |||||||||  ||    a
3' gua uc ucuacuucgacgg c uacuagacu  cg    a
      c  u             c -         ag  acca 

Deep sequencing

87082 reads, 5.86e+04 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context

• Coordinates (MSU7): Chr3: 3347682-3347763 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001112

Mature sequence osa-miR167g

• Accession: MIMAT0001042
• Sequence: 11 - ugaagcugccagcaugaucug - 31
• Deep sequencing: 86978 reads, 2 experiments
• Evidence: by similarity; MI0000208
• Database links:
  • RNAcentral:URS00004B5529_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).