Stem-loop sequence osa-MIR171g

Accession

MI0001138 (change log)

Description

Oryza sativa miR171g stem-loop

Gene family

MIPF0000104; MIR171_2

Literature search

42 open access papers mention osa-MIR171g
(143 sentences)

Stem-loop

          ca        a             agcaa    aaa   c 
5' gacaugg  ugguauug cuuggcucaucuc     cagc   cug a
   |||||||  |||||||| |||||||||||||     ||||   |||  
3' cuguacu  acuauaac gagccgaguggag     gucg   gac u
          uc        c             -----    --c   g 

Deep sequencing

21 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context

• Coordinates (MSU7): Chr7: 15636744-15636832 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001138

Mature sequence osa-miR171g

• Accession: MIMAT0001068
• Sequence: 59 - gaggugagccgagccaauauc - 79
• Deep sequencing: 18 reads, 2 experiments
• Evidence: by similarity; MI0000214
• Database links:
  • RNAcentral:URS00004DD1E6_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).