Stem-loop mmu-mir-411

Accession

MI0001163

Symbol

MGI: Mir411

Description

Mus musculus mmu-mir-411 precursor miRNA

Gene family

MIPF0000126; mir-379

Literature search

22 open access papers mention mmu-mir-411
(69 sentences)

Sequence

876914 reads, 4200 reads per million, 99 experiments

ugguacuuggagagaUAGUAGACCGUAUAGCGUACGcuuuaucugugacgUAUGUAACACGGUCCACUAACCcucaguauca
(((((((..(((.(.((((.((((((...((((((((.........).)))))))...)))))).)))).).))))))))))

Structure

       ug   a a    A      AUA       - uuu 
ugguacu  gag g UAGU GACCGU   GCGUACG c   a
|||||||  ||| | |||| ||||||   ||||||| |   u
acuauga  cuc C AUCA CUGGCA   UGUAUgc g   c
       --   C A    C      CAA       a ugu 

Annotation confidence High

Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the mature sequence from the 3' arm of this hairpin [1]. Landgraf et al. later showed that the 5' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr12: 109710175-109710256 [+]

Clustered miRNAs

15 other miRNAs are < 10 kb from mmu-mir-411

Mature mmu-miR-411-5p

• Accession: MIMAT0004747
• Description: Mus musculus mmu-miR-411-5p mature miRNA
• Sequence: 16 - UAGUAGACCGUAUAGCGUACG - 36
• Evidence: experimental ; cloned [2], Illumina [3-4]

Mature mmu-miR-411-3p

• Accession: MIMAT0001093
• Description: Mus musculus mmu-miR-411-3p mature miRNA
• Sequence: 51 - UAUGUAACACGGUCCACUAACC - 72
• Evidence: experimental ; PCR [1], cloned [2], Illumina [3-4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748