Stem-loop sequence gga-mir-9-2

AccessionMI0001283 (change log)
Previous IDsgga-mir-9
DescriptionGallus gallus miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

19 open access papers mention gga-mir-9-2
(332 sentences)

Stem-loop 
   g    c     g   uc               g      ug u 
5'  gaag gaguu uua  uuugguuaucuagcu uaugag  u u
    |||| ||||| |||  ||||||||||||||| ||||||  |  
3'  cuuc cucaa aau  aagccaauagaucga auacuu  g u
   a    -     a   ga               a      cu g
Get sequence
Deep sequencing
6253930 reads, 6.37e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 60469242-60469328 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-9-2
gga-mir-9-2chrZ: 60469242-60469328 [+]
gga-mir-9b-2chrZ: 60469258-60469312 [-]
Database links

Mature sequence gga-miR-9-5p

Accession MIMAT0001195
Previous IDsgga-miR-9
Sequence

16 -  

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing23818269 reads, 5 experiments
Evidence by similarity; MI0000466

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).