Stem-loop sequence dps-mir-125

AccessionMI0001324 (change log)
DescriptionDrosophila pseudoobscura miR-125 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        gu    au      augg ug  uc  u    c cu         cu  ua 
5' gacau  gcaa  guuugu    c  au  cc gaga c  aacuuguga  uu  a
   |||||  ||||  ||||||    |  ||  || |||| |  |||||||||  ||  u
3' uugua  cguu  caaacg    g  ua  gg cucu g  uugaacacu  ga  a
        gu    --      --ca gu  -u  c    a uu         uu  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 3636011-3636120 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-125
dps-mir-1004_group3: 3634753-3634852 [+]
dps-let-74_group3: 3635655-3635731 [+]
dps-mir-1254_group3: 3636011-3636120 [+]
Database links

Mature sequence dps-miR-125

Accession MIMAT0001230
Sequence

29 - 

ucccugagacccuaacuuguga

 - 50

Get sequence
Evidence by similarity; MI0000417, MI0000417