Stem-loop sequence cbr-mir-356

Accession

MI0001395 (change log)

Description

Caenorhabditis briggsae miR-356 stem-loop

Gene family

MIPF0001209; mir-356

Literature search

1 open access papers mention cbr-mir-356
(1 sentences)

Stem-loop

   ----------------------ccucauccaaccaa     a     -aac   -aa      c   u 
5'                                     ugugg ugagc    gcg   caaauc ucu a
                                       ||||| |||||    |||   |||||| |||  
3'                                     acacc acucg    cgc   guuuag aga u
   gagcagaagacuaaggaccguggaagacuuucgguc     -     ccgc   acc      -   a 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at the two terminal positions.

Genome context

• Coordinates (CB4; GCA_000004555.3): chrIII: 12439556-12439667 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001395

Mature sequence cbr-miR-356

• Accession: MIMAT0001294
• Sequence: 20 - augagcaacgcgaacaaaucc - 40
• Evidence: by similarity; MI0000755

References

1. PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).