Stem-loop sequence ath-MIR419

AccessionMI0001430 (change log)
DescriptionArabidopsis thaliana miR419 stem-loop
Stem-loop 
   aaauua   a       g     g  ---auua        g    guc      u 
5'       uga ugcugag auguu uu       cgagcaau agau   uuuuuu a
         ||| ||||||| ||||| ||       |||||||| ||||   ||||||  
3'       acu acgauuc uacag ag       guucguug uuua   aaaaaa a
   -uuuaa   -       -     g  aacguuc        g    --a      a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 15660370-15660475 [+]
intergenic
Database links

Mature sequence ath-miR419

Accession MIMAT0001327
Sequence

4 -  

uuaugaaugcugaggauguug

 - 24

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).