Stem-loop sequence osa-MIR417

AccessionMI0001437 (change log)
DescriptionOryza sativa miR417 stem-loop
Literature search

4 open access papers mention osa-MIR417
(4 sentences)

Stem-loop 
   uu   u         ---a    uuaa   ucuu 
5'   ugg acaaauuug    auuc    auc    a
     ||| |||||||||    ||||    |||    u
3'   acc uguuuaagu    uaag    uag    a
   gu   u         gaug    --ua   uauu
Get sequence
Deep sequencing
16 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 14939853-14939918 [+]
intergenic
Database links

Mature sequence osa-miR417

Accession MIMAT0001333
Sequence

44 -  

gaauguagugaauuuguucca

 - 64

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0001428

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).