Stem-loop sequence hsa-mir-422a

AccessionMI0001444 (change log)
Symbol HGNC:MIR422A
DescriptionHomo sapiens miR-422a stem-loop
Gene family MIPF0000548; mir-422
Literature search

30 open access papers mention hsa-mir-422a
(245 sentences)

Stem-loop 
   -----   --a     ac   a       u    ag    ga    - uc 
5'      gag   gaagc  ugg cuuaggg caga  gccu  gucu c  u
        |||   |||||  ||| ||||||| ||||  ||||  |||| |   
3'      cuc   uuucg  acc gaguccc gucu  cggg  uaga g  g
   ggucc   cug     -a   -       u    cu    --    c uc
Get sequence
Deep sequencing
7776 reads, 7.52 reads per million, 133 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR-422a is an predicted paralogue of miR-422b (MI0001443), later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 63870930-63871019 [-]
sense
OTTHUMT00000418512 ; RP11-265M18.2-006; intron 1
OTTHUMT00000418513 ; RP11-265M18.2-005; intron 1
OTTHUMT00000418515 ; RP11-265M18.2-004; intron 2
ENST00000560350 ; USP3-AS1-006; intron 1
ENST00000559357 ; USP3-AS1-005; intron 1
ENST00000559861 ; USP3-AS1-004; intron 2
antisense
OTTHUMT00000418505 ; USP3-015; intron 4
OTTHUMT00000417777 ; USP3-008; intron 9
OTTHUMT00000417779 ; USP3-006; intron 9
OTTHUMT00000417776 ; USP3-004; intron 10
OTTHUMT00000417778 ; USP3-005; intron 10
OTTHUMT00000417773 ; USP3-001; intron 11
OTTHUMT00000417774 ; USP3-003; intron 12
OTTHUMT00000417775 ; USP3-002; intron 12
ENST00000559873 ; USP3-015; intron 4
ENST00000539772 ; USP3-203; intron 5
ENST00000559257 ; USP3-008; intron 9
ENST00000559711 ; USP3-006; intron 9
ENST00000558285 ; USP3-004; intron 10
ENST00000538686 ; USP3-005; intron 10
ENST00000540797 ; USP3-204; intron 10
ENST00000380324 ; USP3-001; intron 11
ENST00000558157 ; USP3-003; intron 12
ENST00000559192 ; USP3-002; intron 12
ENST00000268049 ; USP3-201; intron 12
Database links

Mature sequence hsa-miR-422a

Accession MIMAT0001339
Sequence

10 -  

acuggacuuagggucagaaggc

 - 31

Get sequence
Deep sequencing7726 reads, 129 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).