![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-422a |
|||||
Accession | MI0001444 (change log) | ||||
Symbol | HGNC:MIR422A | ||||
Description | Homo sapiens miR-422a stem-loop | ||||
Gene family | MIPF0000548; mir-422 | ||||
Literature search |
![]()
30 open access papers mention hsa-mir-422a | ||||
Stem-loop |
----- --a ac a u ag ga - uc 5' gag gaagc ugg cuuaggg caga gccu gucu c u ||| ||||| ||| ||||||| |||| |||| |||| | 3' cuc uuucg acc gaguccc gucu cggg uaga g g ggucc cug -a - u cu -- c uc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
miR-422a is an predicted paralogue of miR-422b (MI0001443), later verified in human [2]. |
||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-422a |
|
Accession | MIMAT0001339 |
Sequence |
10 - acuggacuuagggucagaaggc - 31 |
Deep sequencing | 7726 reads, 129 experiments |
Evidence | experimental; cloned [2] |
Predicted targets |
|
References |
|
1 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|