![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-431 |
||||||||||||||||||||||||||||
Accession | MI0001524 (change log) | |||||||||||||||||||||||||||
Symbol | MGI:Mir431 | |||||||||||||||||||||||||||
Description | Mus musculus miR-431 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000142; mir-431 | |||||||||||||||||||||||||||
Literature search |
![]()
21 open access papers mention mmu-mir-431 | |||||||||||||||||||||||||||
Stem-loop |
----- c u c u a ---- aca 5' cguc ugcgagg gucuugcagg cg c ugcag gcc c |||| ||||||| |||||||||| || | ||||| ||| 3' gcag acgcucu cgggacguuc gc g acguu ugg u cuaca a u u u g gcaa cag |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-431-5p |
|
Accession | MIMAT0001418 |
Previous IDs | mmu-miR-431 |
Sequence |
13 - ugucuugcaggccgucaugca - 33 |
Deep sequencing | 92757 reads, 67 experiments |
Evidence | experimental; PCR [1], cloned [2-3], insitu [2], Northern [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-431-3p |
|
Accession | MIMAT0004753 |
Previous IDs | mmu-miR-431* |
Sequence |
56 - caggucgucuugcagggcuucu - 77 |
Deep sequencing | 8919 reads, 57 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15854907
"RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus"
Curr Biol. 15:743-749(2005).
|
2 |
PMID:16566924
"Identification of new central nervous system specific mouse microRNAs"
FEBS Lett. 580:2195-2200(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|