miRBase entry: mmu-mir-433

Stem-loop mmu-mir-433


Accession
MI0001525
Symbol
MGI: Mir433
Description
Mus musculus mmu-mir-433 precursor miRNA
Gene family
MIPF0000177; mir-433

Literature search
38 open access papers mention mmu-mir-433
(355 sentences)

Sequence

89238 reads, 625 reads per million, 93 experiments
ugcccggggagaagUACGGUGAGCCUGUCAUUAUUCagagaggcuagauccucuguguugagaaggAUCAUGAUGGGCUCCUCGGUGUucuccagguagcggcaccacaccaugaaggcagccc
((((...((((((...(((.(((((((((((.(((((.(((((......))))).))........))).))))))))))).)))...)))))).))))..(((.((..........))..))).

Structure
--------------------------    cgg      gUA   U           U   --------  g     cu 
                          ugcc   ggagaa   CGG GAGCCUGUCAU AUU        Ca agagg  a
                          ||||   ||||||   ||| ||||||||||| |||        || |||||   
                          augg   ccucuU   GCU CUCGGGUAGUA UAg        gu ucucc  g
cccgacggaaguaccacaccacggcg    --a      GUG   C           C   gaagaguu  g     ua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr12: 109591715-109591838 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from mmu-mir-433
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-433-5p

Accession MIMAT0001419
Description Mus musculus mmu-miR-433-5p mature miRNA
Sequence 15 - UACGGUGAGCCUGUCAUUAUUC - 36
Evidence experimental
PCR [1], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-433-3p

Accession MIMAT0001420
Description Mus musculus mmu-miR-433-3p mature miRNA
Sequence 67 - AUCAUGAUGGGCUCCUCGGUGU - 88
Evidence experimental
PCR [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15854907
    RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus
    "Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C"
    "Curr Biol (2005) 15:743-749