Stem-loop sequence sbi-MIR168

AccessionMI0001556 (change log)
DescriptionSorghum bicolor miR168 stem-loop
Gene family MIPF0000081; MIR168
Literature search

1 open access papers mention sbi-MIR168
(1 sentences)

Stem-loop
   gcc  c  g   c     gc             au     c   --   -   u 
5'    gc gc ccg cucgg  ucgcuuggugcag  cggga cug  ccg ccg g
      || || ||| |||||  |||||||||||||  ||||| |||  ||| |||  
3'    cg cg ggc gagcc  agugaaccacguu  gcccu gac  ggc ggc c
   -gc  a  a   c     ua             cc     a   ag   a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 2247075-2247180 [-]
intergenic
Database links

Mature sequence sbi-miR168

Accession MIMAT0001452
Previous IDssbi-MIR168
Sequence

21 - 

ucgcuuggugcagaucgggac

 - 41

Get sequence
Evidence by similarity; MI0001115

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).