![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sbi-MIR168 |
|||||
Accession | MI0001556 (change log) | ||||
Description | Sorghum bicolor miR168 stem-loop | ||||
Gene family | MIPF0000081; MIR168 | ||||
Literature search |
1 open access papers mention sbi-MIR168 | ||||
Stem-loop |
gcc c g c gc au c -- - u 5' gc gc ccg cucgg ucgcuuggugcag cggga cug ccg ccg g || || ||| ||||| ||||||||||||| ||||| ||| ||| ||| 3' cg cg ggc gagcc agugaaccacguu gcccu gac ggc ggc c -gc a a c ua cc a ag a u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sbi-miR168 |
|
Accession | MIMAT0001452 |
Previous IDs | sbi-MIR168 |
Sequence |
21 - ucgcuuggugcagaucgggac - 41 |
Evidence | by similarity; MI0001115 |
References |
|
1 |
PMID:15916721
"Identification and characterization of new plant microRNAs using EST analysis"
Cell Res. 15:336-360(2005).
|
2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|