![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-365-2 |
|||||
Accession | MI0001645 (change log) | ||||
Symbol | MGI:Mir365-2 | ||||
Description | Mus musculus miR-365-2 stem-loop | ||||
Gene family | MIPF0000061; mir-365 | ||||
Literature search |
![]()
24 open access papers mention mmu-mir-365-2 | ||||
Stem-loop |
agagugaucaa g -- a ac c ----- u u 5' g aca gcaagaa aaugaggg uuu aggggca gcug guu c | ||| ||||||| |||||||| ||| ||||||| |||| ||| 3' c ugu cguucuu uuauuccu aaa uccccgu ugac cag c ----gaggcua g ga g aa - aauac u u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MI0000486). |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-365-2-5p |
|
Accession | MIMAT0017179 |
Previous IDs | mmu-miR-365-2* |
Sequence |
29 - agggacuuucaggggcagcugug - 51 |
Deep sequencing | 10739 reads, 90 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-365-3p |
|
Accession | MIMAT0000711 |
Previous IDs | mmu-miR-365 |
Sequence |
68 - uaaugccccuaaaaauccuuau - 89 |
Deep sequencing | 54125 reads, 105 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|