Stem-loop sequence mmu-mir-365-2

Accession

MI0001645 (change log)

Symbol

MGI:Mir365-2

Description

Mus musculus miR-365-2 stem-loop

Gene family

MIPF0000061; mir-365

Literature search

24 open access papers mention mmu-mir-365-2
(92 sentences)

Stem-loop

   agagugaucaa g   --       a        ac   c       -----    u   u 
5'            g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu c
              | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
3'            c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
   ----gaggcua g   ga       g        aa   -       aauac    u   u 

Deep sequencing

37926 reads, 238 reads per million, 105 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MI0000486).

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 79726400-79726511 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir365-2
• MGI:Mir365-2
• RNAcentral:URS000075E271_10090
• miRBase Tracker:MI0001645

Mature sequence mmu-miR-365-2-5p

• Accession: MIMAT0017179
• Previous IDs: mmu-miR-365-2*
• Sequence: 29 - agggacuuucaggggcagcugug - 51
• Deep sequencing: 10739 reads, 90 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS00005EEDFF_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-365-2-5p
  • miRDB:mmu-miR-365-2-5p

Mature sequence mmu-miR-365-3p

• Accession: MIMAT0000711
• Previous IDs: mmu-miR-365
• Sequence: 68 - uaaugccccuaaaaauccuuau - 89
• Deep sequencing: 54125 reads, 105 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00003E7283_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-365-3p
  • miRDB:mmu-miR-365-3p
  • microrna.org:mmu-miR-365-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).