Stem-loop sequence cfa-mir-449a

AccessionMI0001651 (change log)
Previous IDscfa-mir-449
DescriptionCanis familiaris miR-449 stem-loop
Gene family MIPF0000133; mir-449
Stem-loop 
   -cc     ug     u       -    u          uga  au 
5'    gugug  auggg uggcagu guau guuagcuggu   au  a
      |||||  ||||| ||||||| |||| ||||||||||   ||   
3'    uauac  uauuc aucguca cgua caaucgacua   ua  u
   aca     gu     u       a    -          cgg  ag
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MI0000025).

Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr2: 42541949-42542039 [-]
sense
ENSCAFT00000010869 ; CDC20B-201; intron 1
ENSCAFT00000010868 ; CDC20B-202; intron 2
Clustered miRNAs
< 10kb from cfa-mir-449a
cfa-mir-449bchr2: 42542049-42542177 [-]
cfa-mir-449achr2: 42541949-42542039 [-]
Database links

Mature sequence cfa-miR-449a

Accession MIMAT0001544
Previous IDscfa-miR-449
Sequence

16 -  

uggcaguguauuguuagcuggu

 - 37

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).