![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cfa-mir-449a |
||||||
Accession | MI0001651 (change log) | |||||
Previous IDs | cfa-mir-449 | |||||
Description | Canis familiaris miR-449 stem-loop | |||||
Gene family | MIPF0000133; mir-449 | |||||
Stem-loop |
-cc ug u - u uga au 5' gugug auggg uggcagu guau guuagcuggu au a ||||| ||||| ||||||| |||| |||||||||| || 3' uauac uauuc aucguca cgua caaucgacua ua u aca gu u a - cgg ag |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MI0000025). |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence cfa-miR-449a |
|
Accession | MIMAT0001544 |
Previous IDs | cfa-miR-449 |
Sequence |
16 - uggcaguguauuguuagcuggu - 37 |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|