Stem-loop sequence hsa-mir-450a-1

Accession

MI0001652 (change log)

Previous IDs

hsa-mir-450;hsa-mir-450-1

Symbol

HGNC:MIR450A1

Description

Homo sapiens miR-450a-1 stem-loop

Gene family

MIPF0000128; mir-450

Literature search

20 open access papers mention hsa-mir-450a-1
(42 sentences)

Stem-loop

   --aaac     u       uuu     u              cac 
5'       gauac aaacugu   ugcga guguuccuaauaug   u
         ||||| |||||||   ||||| ||||||||||||||   a
3'       cuaug uuugaua   acguu uacaaggguuauau   u
   auauaa     u       ugu     u              aaa 

Deep sequencing

52145 reads, 275 reads per million, 158 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MI0000313).

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 134540341-134540431 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-450a-1

• hsa-mir-424: chrX: 134546614-134546711 [-]
• hsa-mir-503: chrX: 134546328-134546398 [-]
• hsa-mir-542: chrX: 134541341-134541437 [-]
• hsa-mir-450a-2: chrX: 134540508-134540607 [-]
• hsa-mir-450a-1: chrX: 134540341-134540431 [-]
• hsa-mir-450b: chrX: 134540185-134540262 [-]

Database links

• EntrezGene:MIR450A1
• HGNC:MIR450A1
• RNAcentral:URS000072EA17_9606
• miRBase Tracker:MI0001652

Mature sequence hsa-miR-450a-5p

• Accession: MIMAT0001545
• Previous IDs: hsa-miR-450;hsa-miR-450a
• Sequence: 18 - uuuugcgauguguuccuaauau - 39
• Deep sequencing: 98394 reads, 157 experiments
• Evidence: experimental; array-cloned [1,3], cloned [1,4]
• Database links:
  • RNAcentral:URS00003E5ECC_9606
• Predicted targets:
  • TargetMiner:hsa-miR-450a-5p
  • TargetScanVert:hsa-miR-450a-5p
  • miRDB:hsa-miR-450a-5p
  • microrna.org:hsa-miR-450a-5p

Mature sequence hsa-miR-450a-1-3p

• Accession: MIMAT0022700
• Sequence: 53 - auugggaacauuuugcauguau - 74
• Deep sequencing: 2183 reads, 126 experiments
• Evidence: experimental; Illumina [5]
• Database links:
  • RNAcentral:URS000040BEF4_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-450a-1-3p
  • miRDB:hsa-miR-450a-1-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).