miRBase entry: mmu-mir-450a-1

Stem-loop mmu-mir-450a-1


Accession
MI0001653
Description
Mus musculus mmu-mir-450a-1 precursor miRNA
Gene family
MIPF0000128; mir-450

Literature search
7 open access papers mention mmu-mir-450a-1
(82 sentences)

Sequence

26557 reads, 231 reads per million, 100 experiments
gagagauacugagcuguUUUUGCGAUGUGUUCCUAAUAUgugcuauaauuauAUUGGGAACAUUUUGCAUAAAUagcuuugugucaauaca
....(((((.(((((((((.(((((.((((((((((((((.........)))))))))))))).))))).))))))))).)))))......

Structure
--gaga     u         U     U              ugc 
      gauac gagcuguUU UGCGA GUGUUCCUAAUAUg   u
      ||||| ||||||||| ||||| ||||||||||||||   a
      cugug uucgaUAAA ACGUU UACAAGGGUUAuau   u
acauaa     u         U     U              uaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MIR:MI0000313).

Genome context
chrX: 53048154-53048244 [-]
Clustered miRNAs
6 other miRNAs are < 10 kb from mmu-mir-450a-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-450a-5p

Accession MIMAT0001546
Description Mus musculus mmu-miR-450a-5p mature miRNA
Sequence 18 - UUUUGCGAUGUGUUCCUAAUAU - 39
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-450a-1-3p

Accession MIMAT0017182
Description Mus musculus mmu-miR-450a-1-3p mature miRNA
Sequence 53 - AUUGGGAACAUUUUGCAUAAAU - 74
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15735639
    Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals
    "Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M"
    "Nature (2005) 434:338-345