Stem-loop sequence hcmv-mir-UL22A

AccessionMI0001678 (change log)
Previous IDshcv-miR-UL22A-1;hcmv-mir-UL22A-1
DescriptionHuman cytomegalovirus miR-UL22A stem-loop
Stem-loop 
      g - u       c   cc      guu   g 
5' ccu u c aacuagc uuc  gugaga   uau a
   ||| | | ||||||| |||  ||||||   |||  
3' gga a g uugaucg aag  cacucu   gua a
      g u u       u   ac      -au   c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 27642-27709 [+]
intergenic
Database links

Mature sequence hcmv-miR-UL22A-5p

Accession MIMAT0001574
Previous IDshcv-miR-UL22A-1;hcmv-miR-UL22A-1;hcmv-miR-UL22A
Sequence

7 -  

uaacuagccuucccgugaga

 - 26

Get sequence
Evidence experimental; cloned [1-3], Illumina [4-5]

Mature sequence hcmv-miR-UL22A-3p

Accession MIMAT0001575
Previous IDshcv-miR-UL22A-1*;hcmv-miR-UL22A-1*;hcmv-miR-UL22A*
Sequence

44 -  

ucaccagaaugcuaguuuguag

 - 65

Get sequence
Evidence experimental; cloned [1-3], Illumina [4-5]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:16207254 "Human cytomegalovirus expresses novel microRNAs during productive viral infection" Dunn W, Trang P, Zhong Q, Yang E, van Belle C, Liu F Cell Microbiol. 7:1684-1695(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).
5
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).