miRBase entry: hcmv-mir-UL22A

Stem-loop hcmv-mir-UL22A


Accession
MI0001678
Description
Human cytomegalovirus hcmv-mir-UL22A precursor miRNA


Sequence


ccugucUAACUAGCCUUCCCGUGAGAguuuaugaacauguaucUCACCAGAAUGCUAGUUUGUAGagg
(((.((.(((((((.(((..((((((...............))))))..))).))))))).).).)))

Structure
   g - U       C   CC      guuuau 
ccu u c AACUAGC UUC  GUGAGA      g
||| | | ||||||| |||  ||||||      a
gga A G UUGAUCG AAG  CACUcu      a
   G U U       U   AC      auguac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
HEHCMVCG: 27642-27709 [+]

Disease association
hcmv-mir-UL22A is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hcmv-miR-UL22A-5p

Accession MIMAT0001574
Description Human cytomegalovirus hcmv-miR-UL22A-5p mature miRNA
Sequence 7 - UAACUAGCCUUCCCGUGAGA - 26
Evidence experimental
cloned [1-3], Illumina [4-5]

Mature hcmv-miR-UL22A-3p

Accession MIMAT0001575
Description Human cytomegalovirus hcmv-miR-UL22A-3p mature miRNA
Sequence 44 - UCACCAGAAUGCUAGUUUGUAG - 65
Evidence experimental
cloned [1-3], Illumina [4-5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15782219
    Identification of microRNAs of the herpesvirus family
    "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
    "Nat Methods (2005) 2:269-276

  3. PubMed ID: 16207254
    Human cytomegalovirus expresses novel microRNAs during productive viral infection
    "Dunn W, Trang P, Zhong Q, Yang E, van Belle C, Liu F"
    "Cell Microbiol (2005) 7:1684-1695

  4. PubMed ID: 22013051
    High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection
    "Stark TJ, Arnold JD, Spector DH, Yeo GW"
    "J Virol (2012) 86:226-235

  5. PubMed ID: 22715351
    The microRNA Transcriptome of Human Cytomegalovirus (HCMV)
    "Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS"
    "Open Virol J (2012) 6:38-48