![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hcmv-mir-UL36 |
|||||
Accession | MI0001679 (change log) | ||||
Previous IDs | hcv-miR-UL36-1;hcmv-mir-UL36-1 | ||||
Description | Human cytomegalovirus miR-UL36 stem-loop | ||||
Stem-loop |
- gg uc u 5' ccacgu cguugaagacaccuggaaaga acgu gc c |||||| ||||||||||||||||||||| |||| || 3' ggugcg gcaacuuuuguggaccuuucu ugca cg g u -- -- g |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hcmv-miR-UL36-3p |
|
Accession | MIMAT0004754 |
Previous IDs | hcmv-miR-UL36* |
Sequence |
50 - uuuccagguguuuucaacgugc - 71 |
Evidence | experimental; cloned [3], Illumina [4-5] |
References |
|
1 |
PMID:15782219
"Identification of microRNAs of the herpesvirus family"
Nat Methods. 2:269-276(2005).
|
2 |
PMID:16140786
"Identification and characterization of human cytomegalovirus-encoded microRNAs"
J Virol. 79:12095-12099(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:22013051
"High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection"
J Virol. 86:226-235(2012).
|
5 |
PMID:22715351
"The microRNA Transcriptome of Human Cytomegalovirus (HCMV)"
Open Virol J. 6:38-48(2012).
|