![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hcmv-mir-UL112 |
|||||
Accession | MI0001680 (change log) | ||||
Previous IDs | hcv-miR-UL112-1;hcmv-mir-UL112-1 | ||||
Description | Human cytomegalovirus miR-UL112 stem-loop | ||||
Stem-loop |
cc a g c c cu 5' gacagccu ggauc cau guuacu ag gu g |||||||| ||||| ||| |||||| || || 3' cugucgga ccuag gug caguga uc cg c -- a g a - ac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hcmv-miR-UL112-5p |
|
Accession | MIMAT0026552 |
Sequence |
6 - ccuccggaucacaugguuacuca - 28 |
Evidence | experimental; Illumina [3] |
Mature sequence hcmv-miR-UL112-3p |
|
Accession | MIMAT0001577 |
Previous IDs | hcv-miR-UL112-1;hcmv-miR-UL112-1 |
Sequence |
43 - aagugacggugagauccaggcu - 64 |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
References |
|
1 |
PMID:15782219
"Identification of microRNAs of the herpesvirus family"
Nat Methods. 2:269-276(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:22013051
"High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection"
J Virol. 86:226-235(2012).
|
4 |
PMID:22715351
"The microRNA Transcriptome of Human Cytomegalovirus (HCMV)"
Open Virol J. 6:38-48(2012).
|