Stem-loop sequence hcmv-mir-UL148D

AccessionMI0001681 (change log)
Previous IDshcv-miR-UL148D-1;hcmv-mir-UL148D-1
DescriptionHuman cytomegalovirus miR-UL148D stem-loop
Stem-loop 
   a  a       uu    c    a    -g    gga 
5'  gc ggugagg  gggg ggac acgu  uugc   u
    || |||||||  |||| |||| ||||  ||||    
3'  cg ccacuuc  cccc ccug ugca  agcg   u
   c  -       uu    u    c    ag    gug
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hcmv-miR-UL148D

Accession MIMAT0001578
Previous IDshcv-miR-UL148D-1;hcmv-miR-UL148D-1
Sequence

50 -  

ucguccuccccuucuucaccg

 - 70

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).
4
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).