Stem-loop sequence hcmv-mir-US5-1

AccessionMI0001682 (change log)
Previous IDshcv-miR-US5-1
DescriptionHuman cytomegalovirus miR-US5-1 stem-loop
Stem-loop 
   u              u    u     cag  u 
5'  gaacgcuuucgucg guuu ucaug   cu u
    |||||||||||||| |||| |||||   || u
3'  cuugcgagagcagu cgaa aguac   ga a
   a              c    c     -ca  c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 196060-196125 [+]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-US5-1
hcmv-mir-US4HEHCMVCG: 195149-195232 [+]
hcmv-mir-US5-1HEHCMVCG: 196060-196125 [+]
hcmv-mir-US5-2HEHCMVCG: 196189-196253 [+]
Database links

Mature sequence hcmv-miR-US5-1

Accession MIMAT0001579
Previous IDshcv-miR-US5-1
Sequence

43 -  

ugacaagccugacgagagcgu

 - 63

Get sequence
Evidence experimental; cloned [1,3], Northern [2], Illumina [4-5]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:16140786 "Identification and characterization of human cytomegalovirus-encoded microRNAs" Grey F, Antoniewicz A, Allen E, Saugstad J, McShea A, Carrington JC, Nelson J J Virol. 79:12095-12099(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).
5
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).