Stem-loop sequence hcmv-mir-US5-2

AccessionMI0001683 (change log)
Previous IDshcv-miR-US5-2
DescriptionHuman cytomegalovirus miR-US5-2 stem-loop
Stem-loop 
   g     uu   c          ---cu   a    
5'  gaggc  ucg cacaccuauc     gaa gcg 
    |||||  ||| ||||||||||     ||| || u
3'  uucug  agc guguggauag     cuu cgu 
   u     -u   a          uauuu   a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 196189-196253 [+]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-US5-2
hcmv-mir-US4HEHCMVCG: 195149-195232 [+]
hcmv-mir-US5-1HEHCMVCG: 196060-196125 [+]
hcmv-mir-US5-2HEHCMVCG: 196189-196253 [+]
Database links

Mature sequence hcmv-miR-US5-2-5p

Accession MIMAT0026553
Sequence

6 -  

cuuucgccacaccuauccugaaag

 - 29

Get sequence
Evidence experimental; Illumina [3]

Mature sequence hcmv-miR-US5-2-3p

Accession MIMAT0001580
Previous IDshcv-miR-US5-2
Sequence

42 -  

uaugauaggugugacgaugucu

 - 63

Get sequence
Evidence experimental; cloned [1-2], Illumina [3]

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).