Stem-loop sequence hcmv-mir-US25-1

Accession

MI0001684 (change log)

Previous IDs

hcv-miR-US25-1

Description

Human cytomegalovirus miR-US25-1 stem-loop

Stem-loop

   u u      - uc    gc        ccg  u  u 
5'  g gaaccg c  agug  ucggaccg   gc gu u
    | |||||| |  ||||  ||||||||   || ||  
3'  c cuuggc g  ucgc  agccuggc   cg cg c
   a u      u ga    -a        -ca  -  u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (EMBL:X17403.1): HEHCMVCG: 215245-215314 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hcmv-mir-US25-1

• hcmv-mir-US33: HEHCMVCG: 220470-220539 [-]
• hcmv-mir-US29: HEHCMVCG: 220469-220540 [+]
• hcmv-mir-US25-2: HEHCMVCG: 215447-215536 [-]
• hcmv-mir-US25-1: HEHCMVCG: 215245-215314 [-]
• hcmv-mir-US22: HEHCMVCG: 209922-209993 [+]

Database links

• miRBase Tracker:MI0001684

Mature sequence hcmv-miR-US25-1-5p

• Accession: MIMAT0001581
• Previous IDs: hcv-miR-US25-1;hcmv-miR-US25-1
• Sequence: 5 - aaccgcucaguggcucggacc - 25
• Evidence: experimental; cloned [1-3], Illumina [4-5]

Mature sequence hcmv-miR-US25-1-3p

• Accession: MIMAT0004755
• Previous IDs: hcmv-miR-US25-1*
• Sequence: 48 - uccgaacgcuaggucgguucu - 68
• Evidence: experimental; cloned [3], Illumina [4-5]

References

1. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2. PMID:16207254 "Human cytomegalovirus expresses novel microRNAs during productive viral infection" Dunn W, Trang P, Zhong Q, Yang E, van Belle C, Liu F Cell Microbiol. 7:1684-1695(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).
5. PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).