Stem-loop sequence hcmv-mir-US25-2

Accession

MI0001685 (change log)

Previous IDs

hcv-miR-US25-2

Description

Human cytomegalovirus miR-US25-2 stem-loop

Stem-loop

      uua    --u  g             -    ucuuc        g 
5' cgg   gcgg   cu uucagguggauga gggc     acggucgg c
   |||   ||||   || ||||||||||||| ||||     ||||||||  
3' gcc   cgcc   ga agguucaccuacu uccg     ugucggcu a
      ugg    cuc  g             g    -----        c 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (EMBL:X17403.1): HEHCMVCG: 215447-215536 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hcmv-mir-US25-2

• hcmv-mir-US33: HEHCMVCG: 220470-220539 [-]
• hcmv-mir-US29: HEHCMVCG: 220469-220540 [+]
• hcmv-mir-US25-2: HEHCMVCG: 215447-215536 [-]
• hcmv-mir-US25-1: HEHCMVCG: 215245-215314 [-]
• hcmv-mir-US22: HEHCMVCG: 209922-209993 [+]

Database links

• miRBase Tracker:MI0001685

Mature sequence hcmv-miR-US25-2-5p

• Accession: MIMAT0001582
• Previous IDs: hcv-miR-US25-2-5p
• Sequence: 6 - agcggucuguucagguggauga - 27
• Evidence: experimental; cloned [1-2], Illumina [3-4]

Mature sequence hcmv-miR-US25-2-3p

• Accession: MIMAT0001583
• Previous IDs: hcv-miR-US25-2-3p
• Sequence: 64 - auccacuuggagagcucccgcggu - 87
• Evidence: experimental; cloned [1-2], Illumina [3-4]

References

1. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).
4. PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).