![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hcmv-mir-US25-2 |
||||||||||||
Accession | MI0001685 (change log) | |||||||||||
Previous IDs | hcv-miR-US25-2 | |||||||||||
Description | Human cytomegalovirus miR-US25-2 stem-loop | |||||||||||
Stem-loop |
uua --u g - ucuuc g 5' cgg gcgg cu uucagguggauga gggc acggucgg c ||| |||| || ||||||||||||| |||| |||||||| 3' gcc cgcc ga agguucaccuacu uccg ugucggcu a ugg cuc g g ----- c |
|||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence hcmv-miR-US25-2-5p |
|
Accession | MIMAT0001582 |
Previous IDs | hcv-miR-US25-2-5p |
Sequence |
6 - agcggucuguucagguggauga - 27 |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Mature sequence hcmv-miR-US25-2-3p |
|
Accession | MIMAT0001583 |
Previous IDs | hcv-miR-US25-2-3p |
Sequence |
64 - auccacuuggagagcucccgcggu - 87 |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
References |
|
1 |
PMID:15782219
"Identification of microRNAs of the herpesvirus family"
Nat Methods. 2:269-276(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:22013051
"High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection"
J Virol. 86:226-235(2012).
|
4 |
PMID:22715351
"The microRNA Transcriptome of Human Cytomegalovirus (HCMV)"
Open Virol J. 6:38-48(2012).
|