Stem-loop sequence hcmv-mir-US33

Accession

MI0001686 (change log)

Previous IDs

hcv-miR-US33-1;hcmv-mir-US33-1

Description

Human cytomegalovirus miR-US33 stem-loop

Stem-loop

       g   au     c          g  c acga 
5' cacg uug  ugugc cggaccgugg cg g    a
   |||| |||  ||||| |||||||||| || |     
3' gugc aac  acacg gccuggcacu gc c    a
       a   cu     a          -  - accc 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (EMBL:X17403.1): HEHCMVCG: 220470-220539 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hcmv-mir-US33

• hcmv-mir-US33: HEHCMVCG: 220470-220539 [-]
• hcmv-mir-US29: HEHCMVCG: 220469-220540 [+]
• hcmv-mir-US25-2: HEHCMVCG: 215447-215536 [-]
• hcmv-mir-US25-1: HEHCMVCG: 215245-215314 [-]

Database links

• miRBase Tracker:MI0001686

Mature sequence hcmv-miR-US33-5p

• Accession: MIMAT0001584
• Previous IDs: hcv-miR-US33-1;hcmv-miR-US33-1;hcmv-miR-US33
• Sequence: 8 - gauugugcccggaccgugggcg - 29
• Evidence: experimental; cloned [1-2], Illumina [3-4]

Mature sequence hcmv-miR-US33-3p

• Accession: MIMAT0004756
• Sequence: 45 - ucacgguccgagcacauccaa - 65
• Evidence: experimental; cloned [2], Illumina [3-4]

References

1. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).
4. PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).