miRBase entry: rno-mir-431

Stem-loop rno-mir-431


Accession
MI0001722
Description
Rattus norvegicus rno-mir-431 precursor miRNA
Gene family
MIPF0000142; mir-431

Literature search
6 open access papers mention rno-mir-431
(9 sentences)

Sequence

160450 reads, 273 reads per million, 401 experiments
uccugcgcguccugcgaggUGUCUUGCAGGCCGUCAUGCAggccacacugacgguaacguugcaggucgucuugcagggcuucucgcaagacgacaucuucaucgccaacgacg
....(((((((.(((((((.((((((((((.((.(.((((((((........)))....))))).).)).)))))))))).))))))).))))..........)))........

Structure
----uccu   ----------    c       U          C  U A     ----   aca 
        gcg          cguc ugcgagg GUCUUGCAGG CG C UGCAg    gcc   c
        |||          |||| ||||||| |||||||||| || | |||||    |||    
        cgc          gcag acgcucu cgggacguuc gc g acguu    ugg   u
gcagcaac   uacuucuaca    a       u          u  u g     gcaa   cag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr6: 133711425-133711538 [+]
Clustered miRNAs
11 other miRNAs are < 10 kb from rno-mir-431
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-431

Accession MIMAT0001626
Description Rattus norvegicus rno-miR-431 mature miRNA
Sequence 20 - UGUCUUGCAGGCCGUCAUGCA - 40
Evidence experimental
cloned [2], SOLiD [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249