Dead miRNA entry

miRNA accession:
MI0001727
miRNA ID:
hsa-mir-453
Forward to:
MI0014206
Comment:
miR-453 is processed from the 5p arm of mir-323b. The entries are merged.

Previous miRNA entry

Stem-loop sequence hsa-mir-453

AccessionMI0001727 (change log)
Symbol HGNC:MIR453~withdrawn
DescriptionHomo sapiens miR-453 stem-loop
Stem-loop
      ----g     c       agugccaccucaugguacuc 
5' gca     gaaug ugcgagc                    g
   |||     ||||| |||||||                     
3' cgu     uuuau acgcuug                    g
      aguaa     u       aguggugccuguuggaggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Database links