miRBase entry: dre-mir-152

Stem-loop dre-mir-152


Accession
MI0002017
Description
Danio rerio dre-mir-152 precursor miRNA mir-148
Gene
family?
RF00248; mir-148

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Dre-mir-152 is a microRNA (miRNA) that has been identified as a key regulatory molecule in zebrafish, showing anticorrelation with genes from Cluster 3 and involvement in the G2M checkpoint [PMC7756072]. It is associated with one of three circular RNAs (circRNAs) in a downregulated competing endogenous RNA (ceRNA) subnetwork that may influence osteoclast differentiation [PMC9855694]. Specifically, dre-mir-152 targets the downregulated gene tspan5a during intermuscular bone (IB) growth and interacts with multiple mRNAs and long non-coding RNAs (lncRNAs), playing a pivotal role within ceRNA networks [PMC9855694]. The lncRNAs MSTRG.29519 and MSTRG.19062 may serve as molecular sponges for dre-mir-152, modulating its regulatory effects on tspan5a [PMC9855694]. Additionally, dre-mir-152 is one of the miRNAs with the highest expression levels in certain stages of IB development [PMC7891300].

Literature search
4 open access papers mention dre-mir-152
(5 sentences)

Sequence

2276 reads, 172 reads per million, 11 experiments
cuguucaccuggcucaaguucugugauacacucagacuuugaaucagugguagUCAGUGCAUGACAGAACUUUGGcccgg
.......((.((((.(((((((((.((.((((..((((.............)))))))).)).))))))))).)))).))

Structure
cuguuca  u    c         g  a    ca    uugaa 
       cc ggcu aaguucugu au cacu  gacu     u
       || |||| ||||||||| || ||||  ||||     c
       gg ccGG UUCAAGACA UA GUGA  CUga     a
-------  c    U         G  C    --    uggug 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr3: 24095957-24096036 [+]

Database links

Mature dre-miR-152

Accession MIMAT0001847
Description Danio rerio dre-miR-152 mature miRNA
Sequence 54 - UCAGUGCAUGACAGAACUUUGG - 75
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 15937218
    The developmental miRNA profiles of zebrafish as determined by small RNA cloning
    "Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T"
    "Genes Dev (2005) 19:1288-1293