![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR166d |
||||||
Accession | MI0002221 (change log) | |||||
Description | Populus trichocarpa miR166d stem-loop | |||||
Gene family | MIPF0000004; MIR166 | |||||
Literature search |
![]()
6 open access papers mention ptc-MIR166d | |||||
Stem-loop |
cg a uu g cu a aaga cu 5' ug guugaggggaaug g cugg cgaagcuu agca guuuu c || ||||||||||||| | |||| |||||||| |||| ||||| u 3' ac caacuccccuuac c gacc gcuucgga uugu caaag c ua - uu g ag a -caa aa |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ptc-miR166d |
|
Accession | MIMAT0001927 |
Sequence |
76 - ucggaccaggcuucauucccc - 96 |
Evidence | by similarity; MI0000205 |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|