![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR166h |
|||||
Accession | MI0002225 (change log) | ||||
Description | Populus trichocarpa miR166h stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
6 open access papers mention ptc-MIR166h | ||||
Stem-loop |
acac a cu a c acuuuaagcac 5' aguug ggggaaug gucug uucgaga cauuc a ||||| |||||||| ||||| ||||||| ||||| 3' ucaac ccccuuac cggac aggcucu guaag c -aac c uu c a cuuucuacuua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ptc-miR166h |
|
Accession | MIMAT0001931 |
Sequence |
72 - ucggaccaggcuucauucccc - 92 |
Evidence | by similarity; MI0000206 |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|