![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR168a |
|||||
Accession | MI0002243 (change log) | ||||
Description | Populus trichocarpa miR168a stem-loop | ||||
Gene family | MIPF0000081; MIR168 | ||||
Literature search |
![]()
6 open access papers mention ptc-MIR168a | ||||
Stem-loop |
ggu c u a ug g ---ga auugccagauggcucgacaugacugguuguug 5' cucugauucg uuggugcagg cggga c auucg c uuug u |||||||||| |||||||||| ||||| | ||||| | |||| 3' gaggcuaagu aacuacguuc gcccu g uaagc g aaac g --g c c a gu - auaag aaaaaaaaggacaaaggaaggaaaagaaaaag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ptc-miR168a-5p |
|
Accession | MIMAT0001949 |
Previous IDs | ptc-miR168a |
Sequence |
11 - ucgcuuggugcaggucgggaa - 31 |
Evidence | experimental; cloned [1], miRNAseq [4] |
Mature sequence ptc-miR168a-3p |
|
Accession | MIMAT0022896 |
Sequence |
134 - cccgccuugcaucaacugaau - 154 |
Evidence | experimental; miRNAseq [4] |
References |
|
1 |
PMID:15994906
"Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis"
Plant Cell. 17:2186-2203(2005).
|
2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
3 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|
4 |
PMID:22442676
"Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets"
PLoS One. 7:e33034(2012).
|