Stem-loop sequence ptc-MIR171h

AccessionMI0002284 (change log)
DescriptionPopulus trichocarpa miR171h stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ptc-MIR171h
(11 sentences)

Stem-loop 
   -gaa    ggg        g            u  c    cu     a ua 
5'     agug   gauguugg auggcucaauca au aaau  cccaa c  u
       ||||   |||||||| |||||||||||| || ||||  ||||| |   
3'     ucac   cuauaacc ugccgaguuagu ua uuug  ggguu g  g
   ucaa    --a        g            c  a    cu     - ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 11748061-11748160 [+]
intergenic
Database links

Mature sequence ptc-miR171h-5p

Accession MIMAT0022903
Sequence

13 -  

uguugggauggcucaaucaua

 - 33

Get sequence
Evidence experimental; miRNAseq [3]

Mature sequence ptc-miR171h-3p

Accession MIMAT0001990
Previous IDsptc-miR171h
Sequence

71 -  

ugauugagccgugccaauauc

 - 91

Get sequence
Evidence experimental; cloned [1], miRNAseq [3]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
3
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).