![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR171i |
|||||
Accession | MI0002285 (change log) | ||||
Description | Populus trichocarpa miR171i stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
6 open access papers mention ptc-MIR171i | ||||
Stem-loop |
a au c c -- c uc agugucuuucuucuuc 5' gagug cu gauauuggc ugguuca ucagauc acga u agagcaa u ||||| || ||||||||| ||||||| ||||||| |||| | ||||||| 3' cucau ga cuauaaccg gccgagu aguuuag ugcu g uuuuguu u - cu u u uu u ua cuucuucuucuuuuuc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ptc-miR171i |
|
Accession | MIMAT0001991 |
Sequence |
106 - ugauugagccgugccaauauc - 126 |
Evidence | experimental; cloned [1] |
References |
|
1 |
PMID:15994906
"Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis"
Plant Cell. 17:2186-2203(2005).
|
2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
3 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|