Stem-loop sequence ptc-MIR478c

AccessionMI0002372 (change log)
DescriptionPopulus trichocarpa miR478c stem-loop
Gene family MIPF0000052; MIR478
Literature search

1 open access papers mention ptc-MIR478c
(1 sentences)

Stem-loop 
   uc     ---uu     uuaa       uauuuu g  g  uu     u 
5'   uccuu     uaggg    augucaa      a ac ag  uucua u
     |||||     |||||    |||||||      | || ||  |||||  
3'   aggga     aucuu    ugcaguu      u ug uc  gggau u
   cc     uuuuu     -cug       uuuuau g  g  -u     u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 9861343-9861437 [-]
intergenic
Database links

Mature sequence ptc-miR478c

Accession MIMAT0002078
Sequence

70 -  

ugacgugucuucuauuuuuaggga

 - 93

Get sequence
Evidence experimental; cloned [1], PCR [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).