WARNING: This summary was generated by AI. MIR376B is a microRNA implicated in the post-transcriptional regulation of autophagy-related genes, specifically targeting ATG4 and BECN1, which are critical components in the autophagy pathway [PMC4502651]. This microRNA, along with others, has been identified as a regulator that can inhibit certain stages of the autophagy process [PMC4502651]. To understand the behavior of MIR376B under starvation conditions, researchers conducted a kinetic analysis using TaqMan qPCR and observed the endogenous levels of MIR376B during such stress [PMC3864973].
ccuuc u A U -UUU guga
cagu uuugguauu aaaacGUGGAU UUCCU CUAUG Ac u
|||| ||||||||| ||||||||||| ||||| ||||| ||
gucg aaacuauga uuUUGUACCUA AAGGA GAUAC ug u
----u c A - UAau gucc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0022923 |
| Description | Homo sapiens hsa-miR-376b-5p mature miRNA |
| Sequence | 25 - GUGGAUAUUCCUUCUAUGUUUA - 46 |
| Evidence |
experimental
SOLiD [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0002172 |
| Description | Homo sapiens hsa-miR-376b-3p mature miRNA |
| Sequence | 62 - AUCAUAGAGGAAAAUCCAUGUU - 83 |
| Evidence |
experimental
cloned [3], SOLiD [4] |
| Database links |
|
| Predicted targets |
|
|