In summary, using Cas9 immunoprecipitation we identified the oncogenic MIR483 as a critical component in the regulatory complex of IGF2 imprinting [PMC5470959]. In the present study, MIR483 was discovered to be highly expressed in the tissues of patients with BPD and may be involved in bronchial mucosal necrosis and poor repair after injury [PMC9061009]. To evaluate the phenotypic effects of MIR483 downregulation, the proliferation rate of the MIR483−/− C2C12 cells was measured in both Igf2+/+ and Igf2dGGCT cells, where the ZBED6-Igf2 axis is disrupted [PMC8484269].
- A A G -u ucc gagggg gAAGACGGGAGGA AG AG GAG ggu a |||||| ||||||||||||| || || ||| ||| cucucc cUUCUGCCCUCCU UC UC CUc ccg u u C C A cu cac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004761 |
Description | Homo sapiens hsa-miR-483-5p mature miRNA |
Sequence | 8 - AAGACGGGAGGAAAGAAGGGAG - 29 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0002173 |
Description | Homo sapiens hsa-miR-483-3p mature miRNA |
Sequence | 48 - UCACUCCUCUCCUCCCGUCUU - 68 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links | |
Predicted targets |
|