miRBase entry: kshv-mir-K12-10a

Stem-loop kshv-mir-K12-10a


Accession
MI0002472
Description
Kaposi sarcoma-associated herpesvirus kshv-mir-K12-10a precursor miRNA


Sequence


cuggaGGCUUGGGGCGAUACCACCACUcguuugucuguuggcgauUAGUGUUGUCCCCCCGAGUGGCcag
((((..((((((((.((((.(((...(((((........)))))...))).)))).))))))))..))))

Structure
    aG        C    C   CAC     ugu 
cugg  GCUUGGGG GAUA CAC   Ucguu   c
||||  |||||||| |||| |||   |||||    
gacC  UGAGCCCC CUGU GUG   agcgg   u
    GG        C    U   AUu     uug 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Cai et al. define the likely miRNA primary transcripts in [4].

Genome context
KSU75698: 117967-118036 [-]
Clustered miRNAs
11 other miRNAs are < 10 kb from kshv-mir-K12-10a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature kshv-miR-K12-10a-5p

Accession MIMAT0015212
Description Kaposi sarcoma-associated herpesvirus kshv-miR-K12-10a-5p mature miRNA
Sequence 6 - GGCUUGGGGCGAUACCACCACU - 27
Evidence experimental
Illumina [6], SOLiD [7]

Mature kshv-miR-K12-10a-3p

Accession MIMAT0002179
Description Kaposi sarcoma-associated herpesvirus kshv-miR-K12-10a-3p mature miRNA
Sequence 46 - UAGUGUUGUCCCCCCGAGUGGC - 67
Evidence experimental
cloned [1-3,5], Illumina [6], SOLiD [7]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575

  3. PubMed ID: 15782219
    Identification of microRNAs of the herpesvirus family
    "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
    "Nat Methods (2005) 2:269-276

  4. PubMed ID: 15994824
    Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus
    "Samols MA, Hu J, Skalsky RL, Renne R"
    "J Virol (2005) 79:9301-9305

  5. PubMed ID: 16474131
    Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs
    "Cai X, Cullen BR"
    "J Virol (2006) 80:2234-2242

  6. PubMed ID: 19889781
    In-depth analysis of Kaposi's sarcoma-associated herpesvirus microRNA expression provides insights into the mammalian microRNA-processing machinery
    "Umbach JL, Cullen BR"
    "J Virol (2010) 84:695-703

  7. PubMed ID: 20566670
    Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs
    "Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS"
    "RNA (2010) 16:1540-1558