![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence kshv-mir-K12-10a |
||||||||||||||||||||||||||
Accession | MI0002472 (change log) | |||||||||||||||||||||||||
Description | Kaposi sarcoma-associated herpesvirus miR-K12-10a stem-loop | |||||||||||||||||||||||||
Gene family | MIPF0000261; mir-K12-10 | |||||||||||||||||||||||||
Stem-loop |
ag c c cac ugu 5' cugg gcuugggg gaua cac ucguu c |||| |||||||| |||| ||| ||||| 3' gacc ugagcccc cugu gug agcgg u gg c u auu uug |
|||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||
Comments |
Cai et al. define the likely miRNA primary transcripts in [4]. |
|||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
|
Mature sequence kshv-miR-K12-10a-5p |
|
Accession | MIMAT0015212 |
Previous IDs | kshv-miR-K12-10a* |
Sequence |
6 - ggcuuggggcgauaccaccacu - 27 |
Evidence | experimental; Illumina [6], SOLiD [7] |
Mature sequence kshv-miR-K12-10a-3p |
|
Accession | MIMAT0002179 |
Previous IDs | kshv-miR-K12-10a |
Sequence |
46 - uaguguuguccccccgaguggc - 67 |
Evidence | experimental; cloned [1-3,5], Illumina [6], SOLiD [7] |
References |
|
1 |
PMID:15800047
"Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
Proc Natl Acad Sci U S A. 102:5570-5575(2005).
|
2 |
PMID:15782219
"Identification of microRNAs of the herpesvirus family"
Nat Methods. 2:269-276(2005).
|
3 |
PMID:15994824
"Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus"
J Virol. 79:9301-9305(2005).
|
4 |
PMID:16474131
"Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs"
J Virol. 80:2234-2242(2006).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 | |
7 |
PMID:20566670
"Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs"
RNA. 16:1540-1558(2010).
|