Stem-loop sequence kshv-mir-K12-10b

AccessionMI0002473 (change log)
DescriptionKaposi sarcoma-associated herpesvirus miR-K12-10b stem-loop
Gene family MIPF0000261; mir-K12-10
Stem-loop 
       ag        c    c     c     ugu 
5' cugg  gcuugggg gaua cacca ucguu   c
   ||||  |||||||| |||| ||||| |||||    
3' gacc  ugagcccc cugu guggu agcgg   u
       gg        c    u     u     uug
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Cai et al. define the likely miRNA primary transcripts in [3].

Database links

Mature sequence kshv-miR-K12-10b

Accession MIMAT0002180
Sequence

46 -  

ugguguuguccccccgaguggc

 - 67

Get sequence
Evidence experimental; cloned [1-2,4], Illumina [5], SOLiD [6]

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
PMID:16474131 "Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs" Cai X, Cullen BR J Virol. 80:2234-2242(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:19889781 "In-depth analysis of Kaposi's sarcoma-associated herpesvirus microRNA expression provides insights into the mammalian microRNA-processing machinery" Umbach JL, Cullen BR J Virol. 84:695-703(2010).
6
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).