![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence kshv-mir-K12-10b |
|
Accession | MI0002473 (change log) |
Description | Kaposi sarcoma-associated herpesvirus miR-K12-10b stem-loop |
Gene family | MIPF0000261; mir-K12-10 |
Stem-loop |
ag c c c ugu 5' cugg gcuugggg gaua cacca ucguu c |||| |||||||| |||| ||||| ||||| 3' gacc ugagcccc cugu guggu agcgg u gg c u u uug |
Confidence |
Annotation confidence: not enough data
|
Comments |
Cai et al. define the likely miRNA primary transcripts in [3]. |
Database links |
|
Mature sequence kshv-miR-K12-10b |
|
Accession | MIMAT0002180 |
Sequence |
46 - ugguguuguccccccgaguggc - 67 |
Evidence | experimental; cloned [1-2,4], Illumina [5], SOLiD [6] |
References |
|
1 |
PMID:15800047
"Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
Proc Natl Acad Sci U S A. 102:5570-5575(2005).
|
2 |
PMID:15782219
"Identification of microRNAs of the herpesvirus family"
Nat Methods. 2:269-276(2005).
|
3 |
PMID:16474131
"Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs"
J Virol. 80:2234-2242(2006).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 | |
6 |
PMID:20566670
"Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs"
RNA. 16:1540-1558(2010).
|