![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence kshv-miR-K12-2 |
||||||||||||||||||||||||||
Accession | MI0002476 (change log) | |||||||||||||||||||||||||
Description | Kaposi sarcoma-associated herpesvirus miR-K12-2 stem-loop | |||||||||||||||||||||||||
Stem-loop |
- u u c a g g uc agccauu c 5' gg guc acu cg ua cu uagucc gg gaucug gaag a || ||| ||| || || || |||||| || |||||| |||| 3' cc cag ugg gc gu ga aucggg cc cuagac cuuc a a - c c c g a uu ------- g |
|||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||
Comments |
Cai et al. define the likely miRNA primary transcripts in [2]. |
|||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
|
Mature sequence kshv-miR-K12-2-5p |
|
Accession | MIMAT0002183 |
Previous IDs | kshv-miR-K12-2 |
Sequence |
15 - aacuguaguccgggucgaucug - 36 |
Evidence | experimental; cloned [1], Illumina [3], SOLiD [4] |
Mature sequence kshv-miR-K12-2-3p |
|
Accession | MIMAT0015215 |
Previous IDs | kshv-miR-K12-2* |
Sequence |
58 - gaucuuccagggcuagagcug - 78 |
Evidence | experimental; Illumina [3], SOLiD [4] |
References |
|
1 |
PMID:15800047
"Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
Proc Natl Acad Sci U S A. 102:5570-5575(2005).
|
2 |
PMID:16474131
"Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs"
J Virol. 80:2234-2242(2006).
|
3 | |
4 |
PMID:20566670
"Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs"
RNA. 16:1540-1558(2010).
|