Stem-loop sequence ptr-mir-127

AccessionMI0002583 (change log)
DescriptionPan troglodytes miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

1 open access papers mention ptr-mir-127
(92 sentences)

Stem-loop
   -----  u   ca   ucu      ugcug         g  c      --  a 
5'      ug gau  cug   ccagcc     aagcucaga gg ucugau  uc g
        || |||  |||   ||||||     ||||||||| || ||||||  || a
3'      ac cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   cuacu  u   aa   --u      -----         g  u      cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86127939-86128035 [+]
antisense
ENSPTRT00000012391 ; ptr-mir-136-201; exon 2
Clustered miRNAs
< 10kb from ptr-mir-127
ptr-mir-337chr14: 86119486-86119577 [+]
ptr-mir-665chr14: 86120026-86120096 [+]
ptr-mir-431chr14: 86125968-86126080 [+]
ptr-mir-433chr14: 86126847-86126938 [+]
ptr-mir-127chr14: 86127939-86128035 [+]
ptr-mir-432chr14: 86129447-86129539 [+]
ptr-mir-136chr14: 86129665-86129746 [+]
Database links

Mature sequence ptr-miR-127

Accession MIMAT0002282
Sequence

57 - 

ucggauccgucugagcuuggcu

 - 78

Get sequence
Evidence by similarity; MI0000472
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).