![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-127 |
||||||||||||||||
Accession | MI0002583 (change log) | |||||||||||||||
Description | Pan troglodytes miR-127 stem-loop | |||||||||||||||
Gene family | MIPF0000080; mir-127 | |||||||||||||||
Literature search |
![]()
1 open access papers mention ptr-mir-127 | |||||||||||||||
Stem-loop |
----- u ca ucu ugcug g c -- a 5' ug gau cug ccagcc aagcucaga gg ucugau uc g || ||| ||| |||||| ||||||||| || |||||| || a 3' ac cug ggc ggucgg uucgagucu cc aggcua ag a cuacu u aa --u ----- g u cu a |
|||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
|||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
Mature sequence ptr-miR-127 |
|
Accession | MIMAT0002282 |
Sequence |
57 - ucggauccgucugagcuuggcu - 78 |
Evidence | by similarity; MI0000472 |
Predicted targets |
|
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|