Stem-loop sequence ptr-mir-136

AccessionMI0002593 (change log)
DescriptionPan troglodytes miR-136 stem-loop
Gene family MIPF0000099; mir-136
Stem-loop 
   u        g        c     uuu          uuc 
5'  gagcccuc gaggacuc auuug   ugaugaugga   u
    |||||||| |||||||| |||||   ||||||||||   u
3'  cuugggag cuucugag uaaac   gcuacuaccu   a
   u        a        -     ucu          cgu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86129665-86129746 [+]
sense
ENSPTRT00000054301 ; ptr-mir-136-201; exon 1
antisense
ENSPTRT00000012391 ; ptr-mir-136-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-136
ptr-mir-665chr14: 86120026-86120096 [+]
ptr-mir-431chr14: 86125968-86126080 [+]
ptr-mir-433chr14: 86126847-86126938 [+]
ptr-mir-127chr14: 86127939-86128035 [+]
ptr-mir-432chr14: 86129447-86129539 [+]
ptr-mir-136chr14: 86129665-86129746 [+]
Database links

Mature sequence ptr-miR-136

Accession MIMAT0002292
Sequence

15 -  

acuccauuuguuuugaugaugga

 - 37

Get sequence
Evidence by similarity; MI0000475
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).