Stem-loop sequence hsa-mir-489

AccessionMI0003124 (change log)
Symbol HGNC:MIR489
DescriptionHomo sapiens miR-489 stem-loop
Gene family MIPF0000111; mir-489
Literature search

46 open access papers mention hsa-mir-489
(424 sentences)

Stem-loop 
          c     g             c c    ua     a 
5' guggcag uuggu gucguauguguga g cauu  cuuga c
   ||||||| ||||| ||||||||||||| | ||||  |||||  
3' caucguc aaucg cggcauauacacu c guga  ggauu c
          a     a             a a    --     u
Get sequence
Deep sequencing
867 reads, 0 reads per million, 86 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 93483936-93484019 [-]
antisense
OTTHUMT00000342070 ; GNGT1-005; intron 1
ENST00000455502 ; GNGT1-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-489
hsa-mir-489chr7: 93483936-93484019 [-]
hsa-mir-653chr7: 93482760-93482855 [-]
Database links

Mature sequence hsa-miR-489-5p

Accession MIMAT0026605
Sequence

14 -  

ggucguaugugugacgccauuu

 - 35

Get sequence
Deep sequencing22 reads, 11 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-489-3p

Accession MIMAT0002805
Sequence

52 -  

gugacaucacauauacggcagc

 - 73

Get sequence
Deep sequencing831 reads, 85 experiments
Evidence experimental; array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).