miRBase entry: hsa-mir-495

Stem-loop hsa-mir-495


Accession
MI0003135
Symbol
HGNC: MIR495
Description
Homo sapiens hsa-mir-495 precursor miRNA
Gene family
MIPF0000110; mir-329

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR495 is a microRNA that has been identified as possibly involved in UM tumorigenesis and/or metastasis [PMC2902045]. In a study exploring its role in the regulation of P-gp in MDR lung cancer cells, MIR495 was found to have a greatly elevated efficacy when combined with DOX in CCM/SLI/R-D, resulting in negative volume growth [PMC6841775]. In the RTT-mouse model, MIR495 was found to be significantly overexpressed and described to repress Bdnf [PMC8595945]. The binding ability of SLI to MIR495 was studied using a gel retardation assay, with naked MIR495 serving as a control [PMC6841775]. Additionally, the coating of CCM onto SLI/R-D followed a similar protocol as the binding of MIR495 [PMC6841775]. The EMT- and cancer stemness-promoting activities of intracellular GRP78 may be downregulated by certain endogenous protein factors such as DAL-1 [PMC7226806]. Overall, while limited studies are available on the role of miRNAs, including MIR495, their potential involvement in UM tumorigenesis and metastasis is being investigated [PMC2902045].

Literature search
50 open access papers mention hsa-mir-495
(177 sentences)

Sequence

10129 reads, 162 reads per million, 103 experiments
ugguaccugaaaaGAAGUUGCCCAUGUUAUUUUCGcuuuauaugugacgAAACAAACAUGGUGCACUUCUUuuucgguauca
(((((((.((((((((((.(((((((((..((((((.........).)))))..))))))).)))))))))))).)))))))

Structure
       u          U  -       AU     - uuu 
ugguacc gaaaaGAAGU GC CCAUGUU  UUUCG c   a
||||||| |||||||||| || |||||||  ||||| |   u
acuaugg uuuUUCUUCA CG GGUACAA  AAAgc g   a
       c          -  U       AC     a ugu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101033755-101033836 [+]
Clustered miRNAs
17 other miRNAs are < 10 kb from hsa-mir-495
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-495 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-495-3p

Accession MIMAT0002817
Description Homo sapiens hsa-miR-495-3p mature miRNA
Sequence 50 - AAACAAACAUGGUGCACUUCUU - 71
Evidence experimental
array-cloned [1], cloned [2], SOLiD [3]
Database links
Predicted targets

Mature hsa-miR-495-5p

Accession MIMAT0022924
Description Homo sapiens hsa-miR-495-5p mature miRNA
Sequence 14 - GAAGUUGCCCAUGUUAUUUUCG - 35
Evidence experimental
SOLiD [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 22282338
    Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
    "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
    "RNA (2012) 18:472-484