miRBase entry: hsa-mir-181d

Stem-loop hsa-mir-181d


Accession
MI0003139
Symbol
HGNC: MIR181D
Description
Homo sapiens hsa-mir-181d precursor miRNA
Gene family
MIPF0000007; mir-181

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR181D is a microRNA that has been associated with various biological processes and diseases. The rs8108402 C/T polymorphism, located in the promoter region of MIR181D, has been linked to susceptibility to systemic lupus erythematosus in the Chinese population of Guanxi Province [PMC9396029]. Ectopic expression of MIR181D has been shown to suppress tumor cell growth by downregulating MALT1 [PMC6125328]. However, relative quantification revealed no compensatory up-regulation of MIR181D in miR-181a/b-1 knockout thymocytes [PMC4682956]. MIR181D is involved in the regulation of sterol O-acyltransferase 2 (SOAT2), which plays a crucial role in cholesterol conversion [PMC7460638]. Additionally, MIR181D and other miRNAs have been shown to function as transcriptional regulators by binding to DNA promoters [PMC9967498].

In the context of chronic obstructive pulmonary disease (COPD), downregulation of MIR181D and other miRNAs has been observed in lung tissue, while increased expression of miR223 and miR424-5p has been associated with COPD-related muscle wasting [PMC6089098] [PMC6089098] [PMC6089098]  . These findings suggest that microRNA-mRNA interactions may play important roles in COPD pathogenesis. Furthermore, next-generation sequencing and bioinformatic analyses have revealed interactions between NEAT1, various pseudogenes, miRNAs (including MIR181D), protein-coding genes, rRNAs, snRNAs, and tRNA within the microenvironment of COPD airways [PMC9730017].

In summary, MIR181D is a microRNA involved in various biological processes and diseases. Its polymorphism has been associated with susceptibility to systemic lupus erythematosus, and its ectopic expression has been shown to suppress tumor cell growth. MIR181D is also involved in the regulation of cholesterol conversion and functions as a transcriptional regulator. In the context of COPD, downregulation of MIR181D and other miRNAs has been observed in lung tissue, while increased expression of certain miRNAs has been associated with muscle wasting. The interactions between MIR181D and other molecules within the COPD airway microenvironment have also been identified.

Literature search
240 open access papers mention hsa-mir-181d
(867 sentences)

Sequence

46085 reads, 306 reads per million, 117 experiments
guccccuccccuaggccacagccgaggucacaaucAACAUUCAUUGUUGUCGGUGGGUugugaggacugaggccagacCCACCGGGGGAUGAAUGUCACuguggcugggccagacacggcuuaaggggaauggggac
(((((((((((((((((...(((..(((((((....(((((((((....((((((((((.((.(........)))))))))))))..)))))))))...))))))).))).......))))).))))))..))))))

Structure
      --      -     ----aca   ga       aucA         GUUG          g  a gac 
gucccc  uccccu aggcc       gcc  ggucaca    ACAUUCAUU    UCGGUGGGUu ug g   u
||||||  |||||| |||||       |||  |||||||    |||||||||    |||||||||| || |    
cagggg  agggga uucgg       cgg  ucggugu    UGUAAGUAG    GGCCACCcag ac c   g
      ua      a     cacagac   -g       -CAC         --GG          -  - gga 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr19: 13874875-13875011 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181d
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181d is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181d-5p

Accession MIMAT0002821
Description Homo sapiens hsa-miR-181d-5p mature miRNA
Sequence 36 - AACAUUCAUUGUUGUCGGUGGGU - 58
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-181d-3p

Accession MIMAT0026608
Description Homo sapiens hsa-miR-181d-3p mature miRNA
Sequence 79 - CCACCGGGGGAUGAAUGUCAC - 99
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45