MIR512-1 is a miRNA gene belonging to the C19MC miRNA cluster, which is known for its complex methylation patterns and tissue-specific expression [PMC3975056]. The TCGA miRNA-seq dataset for liver hepatocellular carcinoma (LIHC) and the HCC-iCluster RNA-seq dataset were integrated to analyze the expression of C19MC miRNAs, including MIR512-1 [PMC7378193]. Methylation profiling has revealed that the MIR512-1 cluster's promoter is maternally methylated in placental tissue but fully methylated in somatic tissues, indicating a tissue-specific methylation pattern [PMC3975056]. The differentially methylated region (DMR) of MIR512-1 is unmethylated in hydatidiform moles and partially methylated in placenta, spanning approximately 5 kb including a promoter CpG island [PMC3975056]. Unlike most placental-specific DMRs, which do not inherit methylation from gametes and are unmethylated in human embryonic stem cells (hES cells), MIR512-1 exhibits restricted paternal expression in placenta with complex allelic expression patterns [PMC3975056'>PMC3975056]. This unique imprinting pattern of MIR512-1 does not extend to the nearby MIR371/2 cluster but does show reciprocal imprinting with ZNF331 [PMC3975056]. The study also raises the possibility of additional unknown imprinted DMRs that may exist exclusively in placental tissues, as suggested by the distinct methylation profiles of MIR512-1 and GPR1-AS DMRs [PMC3975056].
 
                            u ug CA CU G uggug cucaguc ugg CUCAGC UGA GGCACUUUC c ||||||| ||| |||||| ||| ||||||||| gagucag acC GAGUCG ACU UCGUGAAag c g ua UG AU G uaaga
| Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0002822 | 
| Description | Homo sapiens hsa-miR-512-5p mature miRNA | 
| Sequence | 14 - CACUCAGCCUUGAGGGCACUUUC - 36 | 
| Evidence | experimental array-cloned [1] | 
| Accession | MIMAT0002823 | 
| Description | Homo sapiens hsa-miR-512-3p mature miRNA | 
| Sequence | 51 - AAGUGCUGUCAUAGCUGAGGUC - 72 | 
| Evidence | experimental array-cloned [1], cloned [2] | 
| Database links |       | 
| Predicted targets |       | 
| 
 |