miRBase entry: hsa-mir-520f

Stem-loop hsa-mir-520f


Accession
MI0003146
Symbol
HGNC: MIR520F
Description
Homo sapiens hsa-mir-520f precursor miRNA
Gene family
MIPF0000020; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR520F is a miRNA gene that has been studied in various contexts. In glioblastoma patients, the levels of MIR520F, along with other miRNAs such as miR-21, miR-218, and miR-193b, were found to correlate with those detected from tissue biopsies [PMC6679205]. In hepatocellular carcinoma (HCC), the TCGA miRNA-seq dataset was used to analyze the cumulative expression of all 46 C19MC miRNA genes, including MIR520F [PMC7378193]. Furthermore, in glioblastoma patients, a panel of nine miRNAs including MIR520F was found to correlate with tissue biopsies and showed associations with tumor volume [PMC7014190] [PMC9965735]. Additionally, MIR520F was listed as part of a group of microRNAs detected in cerebrospinal fluid (CSF) samples [PMC8833415]. In breast invasive carcinoma samples, cumulative expression analysis included MIR520F among the 46 C19MC miRNA genes studied [PMC6193703]. Finally, in the context of recurrent pregnancy loss (RPL), MIR520F was found to be downregulated along with other microRNAs such as miR3175 and miR4672 [PMC5572592]. These studies highlight the involvement and potential significance of MIR520F in various diseases and biological processes.

Literature search
36 open access papers mention hsa-mir-520f
(189 sentences)

Sequence

252 reads, 22 reads per million, 8 experiments
ucucaggcugugacCCUCUAAAGGGAAGCGCUUUCUguggucagaaagaaaagcAAGUGCUUCCUUUUAGAGGGUUaccguuuggga
((((((((.((((((((((((((((((((((((((((....)))).........)))))))))))))))))))))))).))))))))

Structure
        u                        ---------    u 
ucucaggc gugacCCUCUAAAGGGAAGCGCUU         UCUg g
|||||||| ||||||||||||||||||||||||         ||||  
aggguuug caUUGGGAGAUUUUCCUUCGUGAA         agac g
        c                        cgaaaagaa    u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 53682159-53682245 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from hsa-mir-520f
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-520f is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-520f-3p

Accession MIMAT0002830
Description Homo sapiens hsa-miR-520f-3p mature miRNA
Sequence 55 - AAGUGCUUCCUUUUAGAGGGUU - 76
Evidence experimental
array-cloned [1], Illumina [2]
Database links
Predicted targets

Mature hsa-miR-520f-5p

Accession MIMAT0026609
Description Homo sapiens hsa-miR-520f-5p mature miRNA
Sequence 15 - CCUCUAAAGGGAAGCGCUUUCU - 36
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45