Stem-loop sequence hsa-mir-518f

AccessionMI0003154 (change log)
Symbol HGNC:MIR518F
DescriptionHomo sapiens miR-518f stem-loop
Gene family MIPF0000020; mir-515
Literature search

13 open access papers mention hsa-mir-518f
(22 sentences)

Stem-loop 
        ugcu    c               a     ---    gu 
5' ucuca    guga ccucuagagggaagc cuuuc   ucuu  c
   |||||    |||| ||||||||||||||| |||||   ||||   
3' agagu    cauu ggagauuucucuucg gaaag   agaa  u
        uucu    a               c     aaa    aa
Get sequence
Deep sequencing
225 reads, 6.56 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53700015-53700101 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-518f
hsa-mir-520achr19: 53690881-53690965 [+]
hsa-mir-526bchr19: 53694393-53694475 [+]
hsa-mir-519bchr19: 53695213-53695293 [+]
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
Database links

Mature sequence hsa-miR-518f-5p

Accession MIMAT0002841
Previous IDshsa-miR-518f*
Sequence

16 -  

cucuagagggaagcacuuucuc

 - 37

Get sequence
Deep sequencing148 reads, 43 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-518f-3p

Accession MIMAT0002842
Previous IDshsa-miR-518f
Sequence

53 -  

gaaagcgcuucucuuuagagg

 - 73

Get sequence
Deep sequencing66 reads, 26 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).