Stem-loop sequence hsa-mir-519d

AccessionMI0003162 (change log)
Symbol HGNC:MIR519D
DescriptionHomo sapiens miR-519d stem-loop
Gene family MIPF0000020; mir-515
Literature search

42 open access papers mention hsa-mir-519d
(164 sentences)

Stem-loop 
        u  u     c   c       a      uc      uuu 
5' uccca gc gugac cuc aaaggga gcgcuu  uguuug   u
   ||||| || ||||| ||| ||||||| ||||||  ||||||    
3' agggu ug cauug gag uuucccu cgugaa  acaaau   c
        u  c     u   a       c      --      ucu
Get sequence
Deep sequencing
244 reads, 3.23 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53713347-53713434 [+]
sense
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 4
ENST00000597550 ; CTD-2245F17.3-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-519d
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
Database links

Mature sequence hsa-miR-519d-5p

Accession MIMAT0026610
Sequence

15 -  

ccuccaaagggaagcgcuuucuguu

 - 39

Get sequence
Deep sequencing24 reads, 10 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-519d-3p

Accession MIMAT0002853
Sequence

54 -  

caaagugccucccuuuagagug

 - 75

Get sequence
Deep sequencing196 reads, 51 experiments
Evidence experimental; array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).