MIR519D is a microRNA implicated in various cellular processes and diseases, including cancer [PMC8235499]. While it was not up-regulated in hypoxic hepatocellular carcinoma (HCC) cells [PMC5074303], it has been reported to be overexpressed in the majority of central nervous system (CNS) tumors, contradicting a previous report of its down-regulation and tumor-suppressive properties [PMC8235499]. In the context of non-alcoholic fatty liver disease (NAFLD), MIR519D is among the miRNAs that are elevated and directly target PPARα mRNA [PMC9775974]. It has been validated to play a role in HCC tumorigenesis, along with other differentially expressed miRNAs (DEMs) [PMC6338110]. MIR519D is also associated with stem cell biology and tumorigenesis as part of the chromosome 19 microRNA cluster C19MC [PMC8508841]. Its expression was found to be increased in adipogenesis promoting stem cells but decreased in a subsequent stage of these cells, indicating its role in adipogenesis regulation [PMC6307768]. Furthermore, hypomethylation has been associated with increased expression of MIR519D in HCC, suggesting epigenetic regulation as a factor influencing its expression levels [PMC8904560].
u u C C A UC uuu uccca gc gugac CUC AAAGGGA GCGCUU UGUUug u ||||| || ||||| ||| ||||||| |||||| |||||| agggu ug cauuG GAG UUUCCCU CGUGAA ACaaau c u c U A C -- ucu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002853 |
Description | Homo sapiens hsa-miR-519d-3p mature miRNA |
Sequence | 54 - CAAAGUGCCUCCCUUUAGAGUG - 75 |
Evidence |
experimental
array-cloned [1], cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026610 |
Description | Homo sapiens hsa-miR-519d-5p mature miRNA |
Sequence | 15 - CCUCCAAAGGGAAGCGCUUUCUGUU - 39 |
Evidence |
experimental
Illumina [3] |
|