miRBase entry: hsa-mir-521-2

Stem-loop hsa-mir-521-2


Accession
MI0003163
Symbol
HGNC: MIR521-2
Description
Homo sapiens hsa-mir-521-2 precursor miRNA
Gene family
MIPF0000020; mir-515

Literature search
10 open access papers mention hsa-mir-521-2
(15 sentences)

Sequence

12 reads, 2 reads per million, 8 experiments
ucucgggcugugacucuccaaagggaagaauuuucucuugucuaaaagaaaagAACGCACUUCCCUUUAGAGUGUuaccgugugaga
(((((.((.(((((.(((.(((((((((....(((((((......))))...)))....))))))))).))).))))).)).)))))

Structure
     g  u     u   c         aauu   ---    gu 
ucucg gc gugac cuc aaagggaag    uuc   ucuu  c
||||| || ||||| ||| |||||||||    |||   ||||   
agagu ug cauUG GAG UUUCCCUUC    AAg   agaa  u
     g  c     U   A         ACGC   aaa    aa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 53716594-53716680 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from hsa-mir-521-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-521-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-521

Accession MIMAT0002854
Description Homo sapiens hsa-miR-521 mature miRNA
Sequence 54 - AACGCACUUCCCUUUAGAGUGU - 75
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770